Review





Similar Products

95
OriGene control scrambled shrna lentivirus
Control Scrambled Shrna Lentivirus, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/pGFP-C-shLenti+shRNA+Vector/bio_rxiv__64898__2026__05__07__723592-192-12-17
Average 95 stars, based on 1 article reviews
control scrambled shrna lentivirus - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

95
OriGene scramble control shrna
<t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
Scramble Control Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/Scrambled+shRNA+control+in+pRS+shRNA+Vector/pmc13206788-418-9-15
Average 95 stars, based on 1 article reviews
scramble control shrna - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

95
OriGene scramble shrnas
<t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
Scramble Shrnas, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/Scrambled+shRNA+control+in+pRS+shRNA+Vector/pm42119389-90-23-25
Average 95 stars, based on 1 article reviews
scramble shrnas - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

95
OriGene scramble shrna
( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence <t>endogenous</t> <t>RNF10</t> or scramble <t>shRNA</t> (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.
Scramble Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/bio_rxiv__64898__2026__03__31__715507-36-12-16
Average 95 stars, based on 1 article reviews
scramble shrna - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

94
OriGene control mock huh 7 cells
Establishment and validation of Fbxw7 knockdown (FKD) in <t>Huh-7</t> cells. A Immunofluorescence staining demonstrated a marked reduction of Fbxw7 expression in FKD cells ( b ) compared with mock control cells ( a ). Nuclei were counterstained with DAPI. B Western blot analysis confirmed decreased Fbxw7 protein levels in FKD cells, validating the successful establishment of stable Fbxw7-deficient Huh-7 cell lines
Control Mock Huh 7 Cells, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/pRS+shRNA+Vector/pmc13222321-39-0-13
Average 94 stars, based on 1 article reviews
control mock huh 7 cells - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

95
OriGene non targeting scrambled shrna control
( A ) Western blot analysis showing expression of CHOP in control, S1P, and GSK pretreated S1P-treated CD8 + T cells. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( n = 3). ( B ) q-PCR analysis of Ddit3 (encoding CHOP) in respective groups ( n = 3). ( C , D ) Western blot analysis showing expression of CHOP in activated CD8 + T cells upon S1pr1 knockdown using ( C ) siRNA and ( D ) <t>shRNA.</t> The adjacent bar graph depicts normalized densitometric data from three biological replicates ( N = 3, for both ( C , D ). ( E ) Purified mouse CD8⁺ T cells activated under the indicated treatment conditions were analyzed for the production of effector cytokines. The adjacent bar plots represent cumulative data from three biological replicates ( n = 3). ( F ) Purified mouse CD8⁺ T cells activated under the indicated treatment conditions were assessed for the frequency of CD8 + T cells undergoing apoptosis, as determined by Annexin V and 7AAD staining. The adjacent bar plots represent cumulative data from four biological replicates ( n = 4). ( G – L ) C57BL/6 mice ( n = 4 mice/group) with subcutaneously established YUMM1.7 melanoma tumor treated either with vehicle control or GSK, as ( G ) represented schematically, were evaluated for: ( H ) tumor growth, ( I ) the ability of CD8 + T cells from the tumor site to produce different effector cytokines, ( J ) frequency of CD8 + T cells at the tumor site, ( K ) expression of PD1, and ( L ) expression of Tim3 on intratumoral CD8 + T cells. * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001; ns, nonsignificant ( P > 0.05), the error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( I – L ), one-way ANOVA ( A – F ), and two-way ANOVA test ( H ). .
Non Targeting Scrambled Shrna Control, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/pmc13121723-520-39-43
Average 95 stars, based on 1 article reviews
non targeting scrambled shrna control - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

95
OriGene nc gfp
A Experimental timeline. B Left: Maximum projection intensity images of an axon from cells <t>co-expressing</t> <t>NC-GFP</t> (scrambled negative control) and miRFP703-EB3 (far-red tagged EB3 protein). Red arrows ( B – E ) point to the base of the selected projection. Right: Selected axon and kymograph of miRFP703-EB3. For all kymographs ( B – E ), the vertical arrow represents distance, with the base of the arrow positioned towards the soma and the arrowhead positioned towards the tip of the projection. The horizontal arrows represent time progressing from left to right. C Left: Maximum projection intensity images of axons from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected axon and kymograph of miRFP703-EB3. D Left: Maximum projection intensity images of dendrites from cells co-expressing NC-GFP (scrambled negative control) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3. E Left: Maximum projection intensity images of dendrites from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3.The percentage of minus-end-out MTs in axons ( F ) and dendrites ( G ) in NC-GFP or shKIF11 neurons. Two-tailed Unpaired t-test. EB3-comet flux in axons ( H ) and dendrites ( I ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet growth rate in axons ( J ) and dendrites ( K ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet distance traveled (MT growth) in axons ( L ) and dendrites ( M ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s multiple comparison test. N The percentage of minus-end-out MTs in primary, secondary, and tertiary dendrites. Mixed-effects model (REML) followed by Tukey’s test. O EB3-comet flux for plus-end-out and minus-end-out EB3 comets in secondary dendrites. One-way ANOVA, Tukey’s test. For all graphs ( F–O ), error bars represent ±SEM. P -values are listed above respective comparisons. For F , H , J , L , N = 10, 16 neurons and axons for NC-GFP or shKIF11, respectively. For G , I , K , M , N = 16(40), 15(29) neurons (dendrites) for NC-GFP and shKIF11, respectively. For O and N , NC-GFP N = 16 neurons (4 primary, 14 secondary, and 14 tertiary dendrites), shKIF11 N = 15 neurons (4 primary, 16 secondary, and 9 tertiary dendrites). Source data are provided as a file.
Nc Gfp, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/pmc13149629-557-62-63
Average 95 stars, based on 1 article reviews
nc gfp - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

94
OriGene vector control
A Experimental timeline. B Left: Maximum projection intensity images of an axon from cells <t>co-expressing</t> <t>NC-GFP</t> (scrambled negative control) and miRFP703-EB3 (far-red tagged EB3 protein). Red arrows ( B – E ) point to the base of the selected projection. Right: Selected axon and kymograph of miRFP703-EB3. For all kymographs ( B – E ), the vertical arrow represents distance, with the base of the arrow positioned towards the soma and the arrowhead positioned towards the tip of the projection. The horizontal arrows represent time progressing from left to right. C Left: Maximum projection intensity images of axons from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected axon and kymograph of miRFP703-EB3. D Left: Maximum projection intensity images of dendrites from cells co-expressing NC-GFP (scrambled negative control) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3. E Left: Maximum projection intensity images of dendrites from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3.The percentage of minus-end-out MTs in axons ( F ) and dendrites ( G ) in NC-GFP or shKIF11 neurons. Two-tailed Unpaired t-test. EB3-comet flux in axons ( H ) and dendrites ( I ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet growth rate in axons ( J ) and dendrites ( K ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet distance traveled (MT growth) in axons ( L ) and dendrites ( M ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s multiple comparison test. N The percentage of minus-end-out MTs in primary, secondary, and tertiary dendrites. Mixed-effects model (REML) followed by Tukey’s test. O EB3-comet flux for plus-end-out and minus-end-out EB3 comets in secondary dendrites. One-way ANOVA, Tukey’s test. For all graphs ( F–O ), error bars represent ±SEM. P -values are listed above respective comparisons. For F , H , J , L , N = 10, 16 neurons and axons for NC-GFP or shKIF11, respectively. For G , I , K , M , N = 16(40), 15(29) neurons (dendrites) for NC-GFP and shKIF11, respectively. For O and N , NC-GFP N = 16 neurons (4 primary, 14 secondary, and 14 tertiary dendrites), shKIF11 N = 15 neurons (4 primary, 16 secondary, and 9 tertiary dendrites). Source data are provided as a file.
Vector Control, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/Negative+shRNA+control+in+pRS+Vector/pm41793535-121-7-10
Average 94 stars, based on 1 article reviews
vector control - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

96
OriGene non effective 29 mer scrambled negative control shrna
A Experimental timeline. B Left: Maximum projection intensity images of an axon from cells <t>co-expressing</t> <t>NC-GFP</t> (scrambled negative control) and miRFP703-EB3 (far-red tagged EB3 protein). Red arrows ( B – E ) point to the base of the selected projection. Right: Selected axon and kymograph of miRFP703-EB3. For all kymographs ( B – E ), the vertical arrow represents distance, with the base of the arrow positioned towards the soma and the arrowhead positioned towards the tip of the projection. The horizontal arrows represent time progressing from left to right. C Left: Maximum projection intensity images of axons from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected axon and kymograph of miRFP703-EB3. D Left: Maximum projection intensity images of dendrites from cells co-expressing NC-GFP (scrambled negative control) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3. E Left: Maximum projection intensity images of dendrites from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3.The percentage of minus-end-out MTs in axons ( F ) and dendrites ( G ) in NC-GFP or shKIF11 neurons. Two-tailed Unpaired t-test. EB3-comet flux in axons ( H ) and dendrites ( I ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet growth rate in axons ( J ) and dendrites ( K ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet distance traveled (MT growth) in axons ( L ) and dendrites ( M ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s multiple comparison test. N The percentage of minus-end-out MTs in primary, secondary, and tertiary dendrites. Mixed-effects model (REML) followed by Tukey’s test. O EB3-comet flux for plus-end-out and minus-end-out EB3 comets in secondary dendrites. One-way ANOVA, Tukey’s test. For all graphs ( F–O ), error bars represent ±SEM. P -values are listed above respective comparisons. For F , H , J , L , N = 10, 16 neurons and axons for NC-GFP or shKIF11, respectively. For G , I , K , M , N = 16(40), 15(29) neurons (dendrites) for NC-GFP and shKIF11, respectively. For O and N , NC-GFP N = 16 neurons (4 primary, 14 secondary, and 14 tertiary dendrites), shKIF11 N = 15 neurons (4 primary, 16 secondary, and 9 tertiary dendrites). Source data are provided as a file.
Non Effective 29 Mer Scrambled Negative Control Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pmc12985563-151-30-41
Average 96 stars, based on 1 article reviews
non effective 29 mer scrambled negative control shrna - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

Image Search Results


TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

Journal: International Journal of Molecular Sciences

Article Title: Unfolding Immune Dysregulation in COPD: Identification of a Three-Gene Signature and Functional Validation of TCF7 in Human Lung Tissue and T Lymphocytes

doi: 10.3390/ijms27104231

Figure Lengend Snippet: TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

Article Snippet: Short hairpin RNA targeting human TCF7 (shRNA) and a scramble control shRNA were purchased from OriGene with Cat.No.TR30004.

Techniques: Expressing, Immunofluorescence, Staining, Control, Western Blot, Knock-Out, Isolation, shRNA, Construct, Plasmid Preparation

( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence endogenous RNF10 or scramble shRNA (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: ( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence endogenous RNF10 or scramble shRNA (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.

Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

Techniques: Injection, shRNA, Two Tailed Test, Modification

( A ) qRT-PCR analysis for the expression of endogenous RNF10 following injection with scramble shRNA (n=13), shRNF10 (n=13) or shRNF10 + ShResistant (n=10) in the mouse dCA1. Gene expression was normalized to TUBA1A (Brown–Forsythe ANOVA with Dunnett’s T3 multiple comparisons test. p≤0.0001). ( B ) Performance in the object location test 24 h following the sample phase for Scr (n = 14), ShRNF10 (n = 15) and ShRNF10 + ShResistant (n = 14) mice, expressed as the discrimination ratio (One-way ANOVA with Tukey’s post hoc test. Scr vs ShRNF10 p=0.0001; Scr vs Sh+ShResistant p=0.9078; ShRNF10 vs Sh+ShResistant p=0.0004) ( C ) Number of trials (Mixed-effects model with Fisher’s LSD multiple comparisons test. SD: Scr vs ShRNF10 p=0.5918; Scr vs Sh+ShResistant p=0.0656; ShRNF10 vs Sh+ShResistant p=0.1781; SDRe: Scr vs ShRNF10 p=0.0202; Scr vs Sh+ShResistant p=0.1125; ShRNF10 vs Sh+ShResistant p=0.7725) and ( D ) time (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance. SD: Scr vs ShRNF10 p=0.9953; Scr vs Sh+ShResistant p=0.0119; ShRNF10 vs Sh+ShResistant p=0.0130; SDRe: Scr vs ShRNF10 p=0.0456; Scr vs Sh+ShResistant p=0.2449; ShRNF10 vs Sh+ShResistant p=0.6527) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( E ) Latency to make a correct response (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance; SD: Scr vs ShRNF10 p=0.8420; Scr vs Sh+ShResistant p=0.1186; ShRNF10 vs Sh+ShResistant p=0.0855; SDRe: Scr vs ShRNF10 p=0.0543; Scr vs Sh+ShResistant p=0.7026; ShRNF10 vs Sh+ShResistant p=0.1701) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( F ) Number of perseverant and regressive errors made by Scr (n = 19), ShRNF10 (n = 18) and ShRNF10 + ShResistant (n = 13) mice during the SDRe (Kruskal–Wallis test with Dunn’s multiple comparisons test. Perseverant: Scr vs ShRNF10 p=0.0054; Scr vs Sh+ShResistant p>0.9999; ShRNF10 vs Sh+ShResistant p=0.0358; Regressive: Scr vs ShRNF10 p=0.0.6805; Scr vs Sh+ShResistant p=0.0016; ShRNF10 vs Sh+ShResistant p=0.0527). ( G ) Comparison of time required to complete the SD vs SDRe for each group of mice (Wilcoxon test with Holm–Šidák multiple comparisons correction. Scr p<0.0001; ShRNF10 p=0.0201; Sh+ShResistant p=0.1484). Values are expressed as means ± s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001, ****p<0.0001.

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: ( A ) qRT-PCR analysis for the expression of endogenous RNF10 following injection with scramble shRNA (n=13), shRNF10 (n=13) or shRNF10 + ShResistant (n=10) in the mouse dCA1. Gene expression was normalized to TUBA1A (Brown–Forsythe ANOVA with Dunnett’s T3 multiple comparisons test. p≤0.0001). ( B ) Performance in the object location test 24 h following the sample phase for Scr (n = 14), ShRNF10 (n = 15) and ShRNF10 + ShResistant (n = 14) mice, expressed as the discrimination ratio (One-way ANOVA with Tukey’s post hoc test. Scr vs ShRNF10 p=0.0001; Scr vs Sh+ShResistant p=0.9078; ShRNF10 vs Sh+ShResistant p=0.0004) ( C ) Number of trials (Mixed-effects model with Fisher’s LSD multiple comparisons test. SD: Scr vs ShRNF10 p=0.5918; Scr vs Sh+ShResistant p=0.0656; ShRNF10 vs Sh+ShResistant p=0.1781; SDRe: Scr vs ShRNF10 p=0.0202; Scr vs Sh+ShResistant p=0.1125; ShRNF10 vs Sh+ShResistant p=0.7725) and ( D ) time (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance. SD: Scr vs ShRNF10 p=0.9953; Scr vs Sh+ShResistant p=0.0119; ShRNF10 vs Sh+ShResistant p=0.0130; SDRe: Scr vs ShRNF10 p=0.0456; Scr vs Sh+ShResistant p=0.2449; ShRNF10 vs Sh+ShResistant p=0.6527) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( E ) Latency to make a correct response (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance; SD: Scr vs ShRNF10 p=0.8420; Scr vs Sh+ShResistant p=0.1186; ShRNF10 vs Sh+ShResistant p=0.0855; SDRe: Scr vs ShRNF10 p=0.0543; Scr vs Sh+ShResistant p=0.7026; ShRNF10 vs Sh+ShResistant p=0.1701) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( F ) Number of perseverant and regressive errors made by Scr (n = 19), ShRNF10 (n = 18) and ShRNF10 + ShResistant (n = 13) mice during the SDRe (Kruskal–Wallis test with Dunn’s multiple comparisons test. Perseverant: Scr vs ShRNF10 p=0.0054; Scr vs Sh+ShResistant p>0.9999; ShRNF10 vs Sh+ShResistant p=0.0358; Regressive: Scr vs ShRNF10 p=0.0.6805; Scr vs Sh+ShResistant p=0.0016; ShRNF10 vs Sh+ShResistant p=0.0527). ( G ) Comparison of time required to complete the SD vs SDRe for each group of mice (Wilcoxon test with Holm–Šidák multiple comparisons correction. Scr p<0.0001; ShRNF10 p=0.0201; Sh+ShResistant p=0.1484). Values are expressed as means ± s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001, ****p<0.0001.

Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

Techniques: Quantitative RT-PCR, Expressing, Injection, shRNA, Gene Expression, Comparison

(A) Representative images showing dendrites of adult mice dCA1 neurons and protrusion densities (two-tailed unpaired t-test p = 0.7367, n = 37/35) after injecting either RNF10 shRNA or the scramble control (scr; scale bar = 5 μm). ( B ) Violin plots representing, for both conditions dendritic spine width (two-tailed unpaired t-test; p = 0.0002, n = 36/35), and ( C ) dendritic spine length (two-tailed unpaired t-test; p = 0.0006, n = 37,35). ( D ) Representative images showing dendrites of adult mice dCA1 neurons of adult RNF10 KO and WT mice (scale bar = 5 μm) and quantification of protrusion densities (two-tailed unpaired t-test, p = 0.1935, n = 13/16). ( E ) Bar graphs representing, for both conditions, dendritic spine width (two-tailed unpaired t-test, p = 0.0353, n = 13/16) and ( F ) dendritic spine length (two-tailed unpaired t-test, p = 0.0327, n = 13/16). ( G ) Total dendritic length (two-tailed unpaired t-test, p = 0.0033, n = 3) and ( H ) representative sketched neurons and quantification via Sholl analysis (two-tailed paired t-test, p < 0.0001) of CA1 hippocampal neurons from brain slices of adult RNF10 KO and WT mice. ( I ) Total dendritic length (two-tailed unpaired t-test, p = 0.5581, n = 3) and ( J ) representative sketched neurons and quantification via Sholl analysis (F; two-tailed paired t-test, p = 0.5810) of DG hippocampal neurons from brain slices of adult RNF10 KO and WT mice. *p < 0.01, **p < 0.005, ***p<0.001. Values are expressed as means ± s.e.m.

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: (A) Representative images showing dendrites of adult mice dCA1 neurons and protrusion densities (two-tailed unpaired t-test p = 0.7367, n = 37/35) after injecting either RNF10 shRNA or the scramble control (scr; scale bar = 5 μm). ( B ) Violin plots representing, for both conditions dendritic spine width (two-tailed unpaired t-test; p = 0.0002, n = 36/35), and ( C ) dendritic spine length (two-tailed unpaired t-test; p = 0.0006, n = 37,35). ( D ) Representative images showing dendrites of adult mice dCA1 neurons of adult RNF10 KO and WT mice (scale bar = 5 μm) and quantification of protrusion densities (two-tailed unpaired t-test, p = 0.1935, n = 13/16). ( E ) Bar graphs representing, for both conditions, dendritic spine width (two-tailed unpaired t-test, p = 0.0353, n = 13/16) and ( F ) dendritic spine length (two-tailed unpaired t-test, p = 0.0327, n = 13/16). ( G ) Total dendritic length (two-tailed unpaired t-test, p = 0.0033, n = 3) and ( H ) representative sketched neurons and quantification via Sholl analysis (two-tailed paired t-test, p < 0.0001) of CA1 hippocampal neurons from brain slices of adult RNF10 KO and WT mice. ( I ) Total dendritic length (two-tailed unpaired t-test, p = 0.5581, n = 3) and ( J ) representative sketched neurons and quantification via Sholl analysis (F; two-tailed paired t-test, p = 0.5810) of DG hippocampal neurons from brain slices of adult RNF10 KO and WT mice. *p < 0.01, **p < 0.005, ***p<0.001. Values are expressed as means ± s.e.m.

Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

Techniques: Two Tailed Test, shRNA, Control

Establishment and validation of Fbxw7 knockdown (FKD) in Huh-7 cells. A Immunofluorescence staining demonstrated a marked reduction of Fbxw7 expression in FKD cells ( b ) compared with mock control cells ( a ). Nuclei were counterstained with DAPI. B Western blot analysis confirmed decreased Fbxw7 protein levels in FKD cells, validating the successful establishment of stable Fbxw7-deficient Huh-7 cell lines

Journal: Medical Molecular Morphology

Article Title: Loss of Fbxw7 disrupts lipid homeostasis and autophagy in hepatocellular carcinoma cells

doi: 10.1007/s00795-026-00457-3

Figure Lengend Snippet: Establishment and validation of Fbxw7 knockdown (FKD) in Huh-7 cells. A Immunofluorescence staining demonstrated a marked reduction of Fbxw7 expression in FKD cells ( b ) compared with mock control cells ( a ). Nuclei were counterstained with DAPI. B Western blot analysis confirmed decreased Fbxw7 protein levels in FKD cells, validating the successful establishment of stable Fbxw7-deficient Huh-7 cell lines

Article Snippet: Control (mock) Huh‐7 cells were generated by transfecting the empty pRS vector (TR20003; OriGene) without shRNA.

Techniques: Biomarker Discovery, Knockdown, Immunofluorescence, Staining, Expressing, Control, Western Blot

( A ) Western blot analysis showing expression of CHOP in control, S1P, and GSK pretreated S1P-treated CD8 + T cells. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( n = 3). ( B ) q-PCR analysis of Ddit3 (encoding CHOP) in respective groups ( n = 3). ( C , D ) Western blot analysis showing expression of CHOP in activated CD8 + T cells upon S1pr1 knockdown using ( C ) siRNA and ( D ) shRNA. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( N = 3, for both ( C , D ). ( E ) Purified mouse CD8⁺ T cells activated under the indicated treatment conditions were analyzed for the production of effector cytokines. The adjacent bar plots represent cumulative data from three biological replicates ( n = 3). ( F ) Purified mouse CD8⁺ T cells activated under the indicated treatment conditions were assessed for the frequency of CD8 + T cells undergoing apoptosis, as determined by Annexin V and 7AAD staining. The adjacent bar plots represent cumulative data from four biological replicates ( n = 4). ( G – L ) C57BL/6 mice ( n = 4 mice/group) with subcutaneously established YUMM1.7 melanoma tumor treated either with vehicle control or GSK, as ( G ) represented schematically, were evaluated for: ( H ) tumor growth, ( I ) the ability of CD8 + T cells from the tumor site to produce different effector cytokines, ( J ) frequency of CD8 + T cells at the tumor site, ( K ) expression of PD1, and ( L ) expression of Tim3 on intratumoral CD8 + T cells. * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001; ns, nonsignificant ( P > 0.05), the error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( I – L ), one-way ANOVA ( A – F ), and two-way ANOVA test ( H ). .

Journal: EMBO Reports

Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors

doi: 10.1038/s44319-026-00734-3

Figure Lengend Snippet: ( A ) Western blot analysis showing expression of CHOP in control, S1P, and GSK pretreated S1P-treated CD8 + T cells. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( n = 3). ( B ) q-PCR analysis of Ddit3 (encoding CHOP) in respective groups ( n = 3). ( C , D ) Western blot analysis showing expression of CHOP in activated CD8 + T cells upon S1pr1 knockdown using ( C ) siRNA and ( D ) shRNA. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( N = 3, for both ( C , D ). ( E ) Purified mouse CD8⁺ T cells activated under the indicated treatment conditions were analyzed for the production of effector cytokines. The adjacent bar plots represent cumulative data from three biological replicates ( n = 3). ( F ) Purified mouse CD8⁺ T cells activated under the indicated treatment conditions were assessed for the frequency of CD8 + T cells undergoing apoptosis, as determined by Annexin V and 7AAD staining. The adjacent bar plots represent cumulative data from four biological replicates ( n = 4). ( G – L ) C57BL/6 mice ( n = 4 mice/group) with subcutaneously established YUMM1.7 melanoma tumor treated either with vehicle control or GSK, as ( G ) represented schematically, were evaluated for: ( H ) tumor growth, ( I ) the ability of CD8 + T cells from the tumor site to produce different effector cytokines, ( J ) frequency of CD8 + T cells at the tumor site, ( K ) expression of PD1, and ( L ) expression of Tim3 on intratumoral CD8 + T cells. * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001; ns, nonsignificant ( P > 0.05), the error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( I – L ), one-way ANOVA ( A – F ), and two-way ANOVA test ( H ). .

Article Snippet: Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or non-targeting scrambled shRNA control (Origene, USA) 10 μg psPAX2 packaging plasmid 5 μg pMD2.G envelope plasmid Transfection was carried out using the CaCl2/HBS precipitation method.

Techniques: Western Blot, Expressing, Control, Knockdown, shRNA, Purification, Staining, Standard Deviation, Derivative Assay, Two Tailed Test

( A ) Western blot analysis of phospho-p38 (p-p38) and total p38 expression, in vehicle control and S1P-treated CD8 + T cells. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( n = 3). ( B , C ) Western blot analysis showing the expression of p-p38 and total p38 in activated T cells upon S1pr1 knockdown using ( B ) siRNA ( n = 3) and (C) shRNA ( n = 3). The adjacent bar graph depicts normalized densitometric data. ( D ) Western blot analysis of p-p38 and total p38 in CD8 + T cells activated in the presence or absence of S1P, along with the indicated inhibitor. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( n = 3). ( E , F ) qPCR analysis of transcript levels of different ( E ) Map3k and (F) Map2k genes in CD8 + T cells in respective groups ( n = 4). ( G ) CD8 + T cells were activated in the presence or absence of S1P and were collected and processed for chromatin-immunoprecipitation (ChIP) assay with an antibody specific for CHOP or with rabbit IgG control. qPCR primers specific for the known CHOP binding gene ( Dr5 ) and different Map3K and Map2K , along with Mapk14 , were used to determine CHOP binding to the respective promoters ( n = 4). ( H , I ) Purified mouse CD8⁺ T cells activated under the indicated treatment conditions were assessed for: ( H ) T cell death by Annexin V and 7AAD staining and ( I ) frequency of CD8 + T cells producing different effector cytokines. The adjacent bar represents cumulative data from four biological replicates ( n = 4, for both ( H , I )). ( J ) Extracellular flux assay for determining of oxygen consumption rate (OCR) in activated CD8 + T cells in respective groups. * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001; ns, nonsignificant ( P > 0.05), the error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( A ), one-way ANOVA ( B – D , H , I ), and two-way ANOVA test ( E – G ). .

Journal: EMBO Reports

Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors

doi: 10.1038/s44319-026-00734-3

Figure Lengend Snippet: ( A ) Western blot analysis of phospho-p38 (p-p38) and total p38 expression, in vehicle control and S1P-treated CD8 + T cells. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( n = 3). ( B , C ) Western blot analysis showing the expression of p-p38 and total p38 in activated T cells upon S1pr1 knockdown using ( B ) siRNA ( n = 3) and (C) shRNA ( n = 3). The adjacent bar graph depicts normalized densitometric data. ( D ) Western blot analysis of p-p38 and total p38 in CD8 + T cells activated in the presence or absence of S1P, along with the indicated inhibitor. The adjacent bar graph depicts normalized densitometric data from three biological replicates ( n = 3). ( E , F ) qPCR analysis of transcript levels of different ( E ) Map3k and (F) Map2k genes in CD8 + T cells in respective groups ( n = 4). ( G ) CD8 + T cells were activated in the presence or absence of S1P and were collected and processed for chromatin-immunoprecipitation (ChIP) assay with an antibody specific for CHOP or with rabbit IgG control. qPCR primers specific for the known CHOP binding gene ( Dr5 ) and different Map3K and Map2K , along with Mapk14 , were used to determine CHOP binding to the respective promoters ( n = 4). ( H , I ) Purified mouse CD8⁺ T cells activated under the indicated treatment conditions were assessed for: ( H ) T cell death by Annexin V and 7AAD staining and ( I ) frequency of CD8 + T cells producing different effector cytokines. The adjacent bar represents cumulative data from four biological replicates ( n = 4, for both ( H , I )). ( J ) Extracellular flux assay for determining of oxygen consumption rate (OCR) in activated CD8 + T cells in respective groups. * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001; ns, nonsignificant ( P > 0.05), the error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( A ), one-way ANOVA ( B – D , H , I ), and two-way ANOVA test ( E – G ). .

Article Snippet: Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or non-targeting scrambled shRNA control (Origene, USA) 10 μg psPAX2 packaging plasmid 5 μg pMD2.G envelope plasmid Transfection was carried out using the CaCl2/HBS precipitation method.

Techniques: Western Blot, Expressing, Control, Knockdown, shRNA, Chromatin Immunoprecipitation, Binding Assay, Purification, Staining, XF Assay, Standard Deviation, Derivative Assay, Two Tailed Test

( A ) CD8⁺ T cells isolated from either the tumor site or spleen of C57BL/6 mice ( n = 4) bearing YUMM1.7 melanoma were assessed for p-p38 expression. The adjacent bar plot summarizes pooled data from four tumor-bearing mice. ( B ) Intratumoral CD8⁺ T cells from C57BL/6 mice ( n = 4/group) with subcutaneous YUMM1.7 melanoma, treated with vehicle control or p38i, were evaluated for the frequency of terminally exhausted CD8⁺ T cells (PD1⁺Tim3⁺). The adjacent bar plot summarizes pooled data from four mice per group. ( C ) Adoptively transferred Pmel-1 T cells transduced with either control shRNA or shRNA targeting PERK, isolated from tumors of C57BL/6 mice ( n = 4/group) bearing subcutaneous B16-F10 melanoma and treated with or without anti-PD1 antibody, were evaluated for the frequency of terminally exhausted CD8⁺ T cells (PD1⁺Tim3⁺). The adjacent bar plot summarizes pooled data from four mice per group. * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001 ns, nonsignificant ( P > 0.05). The error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( A , B ) and one-way ANOVA. .

Journal: EMBO Reports

Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors

doi: 10.1038/s44319-026-00734-3

Figure Lengend Snippet: ( A ) CD8⁺ T cells isolated from either the tumor site or spleen of C57BL/6 mice ( n = 4) bearing YUMM1.7 melanoma were assessed for p-p38 expression. The adjacent bar plot summarizes pooled data from four tumor-bearing mice. ( B ) Intratumoral CD8⁺ T cells from C57BL/6 mice ( n = 4/group) with subcutaneous YUMM1.7 melanoma, treated with vehicle control or p38i, were evaluated for the frequency of terminally exhausted CD8⁺ T cells (PD1⁺Tim3⁺). The adjacent bar plot summarizes pooled data from four mice per group. ( C ) Adoptively transferred Pmel-1 T cells transduced with either control shRNA or shRNA targeting PERK, isolated from tumors of C57BL/6 mice ( n = 4/group) bearing subcutaneous B16-F10 melanoma and treated with or without anti-PD1 antibody, were evaluated for the frequency of terminally exhausted CD8⁺ T cells (PD1⁺Tim3⁺). The adjacent bar plot summarizes pooled data from four mice per group. * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001 ns, nonsignificant ( P > 0.05). The error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( A , B ) and one-way ANOVA. .

Article Snippet: Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or non-targeting scrambled shRNA control (Origene, USA) 10 μg psPAX2 packaging plasmid 5 μg pMD2.G envelope plasmid Transfection was carried out using the CaCl2/HBS precipitation method.

Techniques: Isolation, Expressing, Control, Transduction, shRNA, Standard Deviation, Derivative Assay, Two Tailed Test

( A – D ) C57BL/6 mice ( n = 4 mice/group) with subcutaneously established YUMM1.7 melanoma tumor treated either with vehicle control or p38i, as ( A ) represented schematically, were evaluated for: ( B ) tumor growth, ( C ) frequency of CD8 + T cells at the tumor site, ( D ) the ability of CD8 + T cells from the tumor site to produce different effector cytokines. ( E ) Schematic representation of the ACT protocol where C57BL/6 mice ( n = 4 mice/group) bearing subcutaneous B16-F10 tumors were adoptively transferred with 0.75 × 10⁶ Pmel-1 T cells, followed by treatment with or without anti-PD1 antibody (Clone# RMP1-14; 200 µg/mouse twice weekly), combined with p38i or vehicle control. Mice were subsequently evaluated for: ( F ) tumor growth ( n = 4), ( G ) frequency of Vβ13 + CD8 + T cells at the tumor site ( n = 4), and ( H ) Intracellular expression of effector cytokines in intratumoral Pmel-1 T cells following in vitro restimulation ( n = 4). ( I ) Schematic representation of the ACT protocol where C57BL/6 mice ( n = 4 mice/group) bearing subcutaneous B16-F10 tumors were adoptively transferred with 0.75 × 10⁶ Pmel-1 T cells transduced with either control shRNA (Pmel WT ) or shRNA targeting PERK (Pmel PERK ), followed by treatment with or without anti-PD1 antibody (Clone# RMP1-14; 200 µg/mouse twice weekly). Mice were evaluated for: ( J ) tumor growth ( n = 4), ( K ) frequency of Vβ13 + CD8 + T cells at the tumor site ( n = 4), and ( L ) Intracellular expression of effector cytokines in intratumoral Pmel-1 T cells following in vitro restimulation ( n = 4). * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001; ns, nonsignificant ( P > 0.05), the error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( C , D ), one-way ANOVA ( G , H , K , L ), and two-way ANOVA test ( B , F , J ). .

Journal: EMBO Reports

Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors

doi: 10.1038/s44319-026-00734-3

Figure Lengend Snippet: ( A – D ) C57BL/6 mice ( n = 4 mice/group) with subcutaneously established YUMM1.7 melanoma tumor treated either with vehicle control or p38i, as ( A ) represented schematically, were evaluated for: ( B ) tumor growth, ( C ) frequency of CD8 + T cells at the tumor site, ( D ) the ability of CD8 + T cells from the tumor site to produce different effector cytokines. ( E ) Schematic representation of the ACT protocol where C57BL/6 mice ( n = 4 mice/group) bearing subcutaneous B16-F10 tumors were adoptively transferred with 0.75 × 10⁶ Pmel-1 T cells, followed by treatment with or without anti-PD1 antibody (Clone# RMP1-14; 200 µg/mouse twice weekly), combined with p38i or vehicle control. Mice were subsequently evaluated for: ( F ) tumor growth ( n = 4), ( G ) frequency of Vβ13 + CD8 + T cells at the tumor site ( n = 4), and ( H ) Intracellular expression of effector cytokines in intratumoral Pmel-1 T cells following in vitro restimulation ( n = 4). ( I ) Schematic representation of the ACT protocol where C57BL/6 mice ( n = 4 mice/group) bearing subcutaneous B16-F10 tumors were adoptively transferred with 0.75 × 10⁶ Pmel-1 T cells transduced with either control shRNA (Pmel WT ) or shRNA targeting PERK (Pmel PERK ), followed by treatment with or without anti-PD1 antibody (Clone# RMP1-14; 200 µg/mouse twice weekly). Mice were evaluated for: ( J ) tumor growth ( n = 4), ( K ) frequency of Vβ13 + CD8 + T cells at the tumor site ( n = 4), and ( L ) Intracellular expression of effector cytokines in intratumoral Pmel-1 T cells following in vitro restimulation ( n = 4). * P < 0.05; ** P < 0.01; *** P < 0.005; **** P < 0.0001; ns, nonsignificant ( P > 0.05), the error bar represents the standard deviation (SD). P values are derived from unpaired two-tailed Student’s t test ( C , D ), one-way ANOVA ( G , H , K , L ), and two-way ANOVA test ( B , F , J ). .

Article Snippet: Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or non-targeting scrambled shRNA control (Origene, USA) 10 μg psPAX2 packaging plasmid 5 μg pMD2.G envelope plasmid Transfection was carried out using the CaCl2/HBS precipitation method.

Techniques: Control, Expressing, In Vitro, Transduction, shRNA, Standard Deviation, Derivative Assay, Two Tailed Test

A Experimental timeline. B Left: Maximum projection intensity images of an axon from cells co-expressing NC-GFP (scrambled negative control) and miRFP703-EB3 (far-red tagged EB3 protein). Red arrows ( B – E ) point to the base of the selected projection. Right: Selected axon and kymograph of miRFP703-EB3. For all kymographs ( B – E ), the vertical arrow represents distance, with the base of the arrow positioned towards the soma and the arrowhead positioned towards the tip of the projection. The horizontal arrows represent time progressing from left to right. C Left: Maximum projection intensity images of axons from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected axon and kymograph of miRFP703-EB3. D Left: Maximum projection intensity images of dendrites from cells co-expressing NC-GFP (scrambled negative control) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3. E Left: Maximum projection intensity images of dendrites from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3.The percentage of minus-end-out MTs in axons ( F ) and dendrites ( G ) in NC-GFP or shKIF11 neurons. Two-tailed Unpaired t-test. EB3-comet flux in axons ( H ) and dendrites ( I ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet growth rate in axons ( J ) and dendrites ( K ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet distance traveled (MT growth) in axons ( L ) and dendrites ( M ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s multiple comparison test. N The percentage of minus-end-out MTs in primary, secondary, and tertiary dendrites. Mixed-effects model (REML) followed by Tukey’s test. O EB3-comet flux for plus-end-out and minus-end-out EB3 comets in secondary dendrites. One-way ANOVA, Tukey’s test. For all graphs ( F–O ), error bars represent ±SEM. P -values are listed above respective comparisons. For F , H , J , L , N = 10, 16 neurons and axons for NC-GFP or shKIF11, respectively. For G , I , K , M , N = 16(40), 15(29) neurons (dendrites) for NC-GFP and shKIF11, respectively. For O and N , NC-GFP N = 16 neurons (4 primary, 14 secondary, and 14 tertiary dendrites), shKIF11 N = 15 neurons (4 primary, 16 secondary, and 9 tertiary dendrites). Source data are provided as a file.

Journal: Nature Communications

Article Title: Intellectual disability-causing mutations in KIF11 impair microtubule dynamics and dendritic arborization

doi: 10.1038/s41467-026-70522-z

Figure Lengend Snippet: A Experimental timeline. B Left: Maximum projection intensity images of an axon from cells co-expressing NC-GFP (scrambled negative control) and miRFP703-EB3 (far-red tagged EB3 protein). Red arrows ( B – E ) point to the base of the selected projection. Right: Selected axon and kymograph of miRFP703-EB3. For all kymographs ( B – E ), the vertical arrow represents distance, with the base of the arrow positioned towards the soma and the arrowhead positioned towards the tip of the projection. The horizontal arrows represent time progressing from left to right. C Left: Maximum projection intensity images of axons from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected axon and kymograph of miRFP703-EB3. D Left: Maximum projection intensity images of dendrites from cells co-expressing NC-GFP (scrambled negative control) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3. E Left: Maximum projection intensity images of dendrites from cells co-expressing shKif11 (shRNA targeting KIF11) and miRFP703-EB3. Right: Selected dendrite and kymograph of miRFP703-EB3.The percentage of minus-end-out MTs in axons ( F ) and dendrites ( G ) in NC-GFP or shKIF11 neurons. Two-tailed Unpaired t-test. EB3-comet flux in axons ( H ) and dendrites ( I ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet growth rate in axons ( J ) and dendrites ( K ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s test. EB3-comet distance traveled (MT growth) in axons ( L ) and dendrites ( M ) in NC-GFP or shKIF11 neurons. One-way ANOVA, Tukey’s multiple comparison test. N The percentage of minus-end-out MTs in primary, secondary, and tertiary dendrites. Mixed-effects model (REML) followed by Tukey’s test. O EB3-comet flux for plus-end-out and minus-end-out EB3 comets in secondary dendrites. One-way ANOVA, Tukey’s test. For all graphs ( F–O ), error bars represent ±SEM. P -values are listed above respective comparisons. For F , H , J , L , N = 10, 16 neurons and axons for NC-GFP or shKIF11, respectively. For G , I , K , M , N = 16(40), 15(29) neurons (dendrites) for NC-GFP and shKIF11, respectively. For O and N , NC-GFP N = 16 neurons (4 primary, 14 secondary, and 14 tertiary dendrites), shKIF11 N = 15 neurons (4 primary, 16 secondary, and 9 tertiary dendrites). Source data are provided as a file.

Article Snippet: DIV14-16 Primary hippocampal mouse neurons, plated in 35 mm Mattek No1.5 dishes were simultaneously transfected via combiMag and Lipofectamine with 0.5 μg EB3-miRFP703 (Addgene #79994) or mRuby-Synaptophysin [(pEF Synaptophysin-mRuby was a gift from Edwin Chapman (Addgene plasmid # 188980; http://n2t.net/addgene:188980 ; RRID:Addgene_188980)] or mApple-PSD95 [mApple-PSD95-N-14 was a gift from Michael Davidson (Addgene plasmid # 54941; http://n2t.net/addgene:54941 ; RRID:Addgene_54941)] and either 0.5 μg NC-GFP (Origene TR30013) or KIF11-shRNA-A (Origene TG501174) or tagged KIF11 constructs.

Techniques: Expressing, Negative Control, shRNA, Two Tailed Test, Comparison

A Experimental timeline. B Left: Maximum projection intensity image from a neuron co-expressing NC-GFP (scrambled negative control) and mRuby-Synaptophysin. Right: Selected axon and kymograph of mRuby-Synaptophysin. For all kymographs ( B , C , I , J ), the vertical arrow represents distance, with the base of the arrow positioned towards the soma and the arrowhead positioned towards the tip of the projection. The horizontal arrows represent time progressing from left to right. C Left: Maximum projection intensity image from a neuron co-expressing shKif11 (shRNA targeting KIF11) and mRuby-Synaptophysin. Right: Selected axon and kymograph of mRuby-Synaptophysin. D . Percentage of mobile mRuby-Synaptophysin in NC-GFP and shKIF11 primary hippocampal neurons’ axons. Two-tailed Unpaired t-test. In D–G N = 11, 12 neurons/axons for NC-GFP and shKif11, respectively. The flux of mRuby-Synaptophysin ( E ), the velocity of mRuby-Synaptophysin ( F ), and the distance traveled of mRuby-Synaptophysin ( G ) in NC-GFP and shKIF11 primary hippocampal neurons. One-way ANOVA, Tukey’s multiple comparison test. H . Experimental timeline. I Left: Maximum projection intensity images of dendrites from cells co-expressing NC-GFP and mApple-PSD95. Right: Selected dendrite and kymograph of mApple-PSD95. J Left: Maximum projection intensity images of dendrites from cells co-expressing shKif11 and mApple-PSD95. Right: Selected dendrite and kymograph of mApple-PSD95. K Percentage of mobile mApple-PSD95 in NC-GFP and shKIF11 primary hippocampal neurons. Two-tailed Unpaired t test. mApple-PSD95 flux ( L ), mApple-PSD95 velocity ( M ), and mApple-PSD95 distance traveled ( N ) in NC-GFP and shKIF11 primary hippocampal neurons. One-way ANOVA. Tukey’s multiple comparison test. In K–N N = 13, 9 neurons/dendrites for NC-GFP and shKif11, respectively. For all figures, white arrowheads point to the base of the selected axon/dendrites, red arrowheads highlight trafficking synaptophysin/PDS95. For all graphs ( D–G , K–N ), error bars represent ±SEM. P -values are listed above respective comparisons. Source data are provided as a file.

Journal: Nature Communications

Article Title: Intellectual disability-causing mutations in KIF11 impair microtubule dynamics and dendritic arborization

doi: 10.1038/s41467-026-70522-z

Figure Lengend Snippet: A Experimental timeline. B Left: Maximum projection intensity image from a neuron co-expressing NC-GFP (scrambled negative control) and mRuby-Synaptophysin. Right: Selected axon and kymograph of mRuby-Synaptophysin. For all kymographs ( B , C , I , J ), the vertical arrow represents distance, with the base of the arrow positioned towards the soma and the arrowhead positioned towards the tip of the projection. The horizontal arrows represent time progressing from left to right. C Left: Maximum projection intensity image from a neuron co-expressing shKif11 (shRNA targeting KIF11) and mRuby-Synaptophysin. Right: Selected axon and kymograph of mRuby-Synaptophysin. D . Percentage of mobile mRuby-Synaptophysin in NC-GFP and shKIF11 primary hippocampal neurons’ axons. Two-tailed Unpaired t-test. In D–G N = 11, 12 neurons/axons for NC-GFP and shKif11, respectively. The flux of mRuby-Synaptophysin ( E ), the velocity of mRuby-Synaptophysin ( F ), and the distance traveled of mRuby-Synaptophysin ( G ) in NC-GFP and shKIF11 primary hippocampal neurons. One-way ANOVA, Tukey’s multiple comparison test. H . Experimental timeline. I Left: Maximum projection intensity images of dendrites from cells co-expressing NC-GFP and mApple-PSD95. Right: Selected dendrite and kymograph of mApple-PSD95. J Left: Maximum projection intensity images of dendrites from cells co-expressing shKif11 and mApple-PSD95. Right: Selected dendrite and kymograph of mApple-PSD95. K Percentage of mobile mApple-PSD95 in NC-GFP and shKIF11 primary hippocampal neurons. Two-tailed Unpaired t test. mApple-PSD95 flux ( L ), mApple-PSD95 velocity ( M ), and mApple-PSD95 distance traveled ( N ) in NC-GFP and shKIF11 primary hippocampal neurons. One-way ANOVA. Tukey’s multiple comparison test. In K–N N = 13, 9 neurons/dendrites for NC-GFP and shKif11, respectively. For all figures, white arrowheads point to the base of the selected axon/dendrites, red arrowheads highlight trafficking synaptophysin/PDS95. For all graphs ( D–G , K–N ), error bars represent ±SEM. P -values are listed above respective comparisons. Source data are provided as a file.

Article Snippet: DIV14-16 Primary hippocampal mouse neurons, plated in 35 mm Mattek No1.5 dishes were simultaneously transfected via combiMag and Lipofectamine with 0.5 μg EB3-miRFP703 (Addgene #79994) or mRuby-Synaptophysin [(pEF Synaptophysin-mRuby was a gift from Edwin Chapman (Addgene plasmid # 188980; http://n2t.net/addgene:188980 ; RRID:Addgene_188980)] or mApple-PSD95 [mApple-PSD95-N-14 was a gift from Michael Davidson (Addgene plasmid # 54941; http://n2t.net/addgene:54941 ; RRID:Addgene_54941)] and either 0.5 μg NC-GFP (Origene TR30013) or KIF11-shRNA-A (Origene TG501174) or tagged KIF11 constructs.

Techniques: Expressing, Negative Control, shRNA, Two Tailed Test, Comparison

A Schema of selected Microcephaly with or without chorioretinopathy, lymphedema, or intellectual disabilities (MCLID) patient mutations ( Hs: Homo sapiens ) and the corresponding mouse homolog (Mm: Mus Musculus ) (adapted from Schlögel et al. ) on the KIF11 protein. B Experimental timeline. C Confocal projection images of primary hippocampal mouse neurons transfected with control or KIF11 constructs, with the soma in the center of the image. Scale Bar=25 µm. D Soma size quantification of ( C ). N = 20,22,22,19 neurons for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Tukey’s test. E Quantification of dendritic morphology changes using Sholl analysis. N = 17,20,20,16 neurons for NC-GFP, KIF11-OE, KIF11 Y81F, and KIF11 ΔCterm , respectively. Two-way ANOVA followed by Tukey’s test. F Plus-end-out EB3-comet flux in KIF11 dendrites in comparison to NC-GFP. N = 17,17,18,21 dendrites for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. G . Minus-end-out EB3-comets flux in KIF11 dendrites in comparison to NC-GFP. N = 14,16,18,21 dendrites for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. H Percentage of Minus-end-out EB3-comets in KIF11 dendrites in comparison to NC-GFP. N = 17,17,18,22 dendrites for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. I . Length of plus-end-out MT growth for KIF11 dendrites in comparison to NC-GFP. N = 17(248),17(59),18(114),22(184) dendrites (# of comets) for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. J Length of minus-end-out MT growth for KIF11 dendrites compared to NC-GFP. N = 17(70),17(42),18(27),22(45) dendrites (# of comets) for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. K Plus-end-out MT growth-rate based on EB3-comet velocities in KIF11 dendrites in comparison to NC-GFP. N = 17(254),17(56),18(130),22(189) dendrites (# of comets) for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. L Minus-end-out MT growth rate based on EB3-comet velocities in KIF11 dendrites in comparison to NC-GFP. N = 17(59),17(49),18(32),22(41) dendrites (# of comets) for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. For all graphs ( D–L ), error bars represent ±SEM. P values are listed above respective comparisons. P values are listed above respective comparisons. Source data are provided as a file.

Journal: Nature Communications

Article Title: Intellectual disability-causing mutations in KIF11 impair microtubule dynamics and dendritic arborization

doi: 10.1038/s41467-026-70522-z

Figure Lengend Snippet: A Schema of selected Microcephaly with or without chorioretinopathy, lymphedema, or intellectual disabilities (MCLID) patient mutations ( Hs: Homo sapiens ) and the corresponding mouse homolog (Mm: Mus Musculus ) (adapted from Schlögel et al. ) on the KIF11 protein. B Experimental timeline. C Confocal projection images of primary hippocampal mouse neurons transfected with control or KIF11 constructs, with the soma in the center of the image. Scale Bar=25 µm. D Soma size quantification of ( C ). N = 20,22,22,19 neurons for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Tukey’s test. E Quantification of dendritic morphology changes using Sholl analysis. N = 17,20,20,16 neurons for NC-GFP, KIF11-OE, KIF11 Y81F, and KIF11 ΔCterm , respectively. Two-way ANOVA followed by Tukey’s test. F Plus-end-out EB3-comet flux in KIF11 dendrites in comparison to NC-GFP. N = 17,17,18,21 dendrites for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. G . Minus-end-out EB3-comets flux in KIF11 dendrites in comparison to NC-GFP. N = 14,16,18,21 dendrites for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. H Percentage of Minus-end-out EB3-comets in KIF11 dendrites in comparison to NC-GFP. N = 17,17,18,22 dendrites for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. I . Length of plus-end-out MT growth for KIF11 dendrites in comparison to NC-GFP. N = 17(248),17(59),18(114),22(184) dendrites (# of comets) for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. J Length of minus-end-out MT growth for KIF11 dendrites compared to NC-GFP. N = 17(70),17(42),18(27),22(45) dendrites (# of comets) for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. K Plus-end-out MT growth-rate based on EB3-comet velocities in KIF11 dendrites in comparison to NC-GFP. N = 17(254),17(56),18(130),22(189) dendrites (# of comets) for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. L Minus-end-out MT growth rate based on EB3-comet velocities in KIF11 dendrites in comparison to NC-GFP. N = 17(59),17(49),18(32),22(41) dendrites (# of comets) for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm , respectively. One-way ANOVA followed by Dunnett’s test. For all graphs ( D–L ), error bars represent ±SEM. P values are listed above respective comparisons. P values are listed above respective comparisons. Source data are provided as a file.

Article Snippet: DIV14-16 Primary hippocampal mouse neurons, plated in 35 mm Mattek No1.5 dishes were simultaneously transfected via combiMag and Lipofectamine with 0.5 μg EB3-miRFP703 (Addgene #79994) or mRuby-Synaptophysin [(pEF Synaptophysin-mRuby was a gift from Edwin Chapman (Addgene plasmid # 188980; http://n2t.net/addgene:188980 ; RRID:Addgene_188980)] or mApple-PSD95 [mApple-PSD95-N-14 was a gift from Michael Davidson (Addgene plasmid # 54941; http://n2t.net/addgene:54941 ; RRID:Addgene_54941)] and either 0.5 μg NC-GFP (Origene TR30013) or KIF11-shRNA-A (Origene TG501174) or tagged KIF11 constructs.

Techniques: Transfection, Control, Construct, Comparison

A Timeline of experimental design to record miniature excitatory post-synaptic potential (mEPSCs) in mouse primary hippocampal culture expressing NC-GFP or KIF11 constructs. Tetrodotoxin (TTX) was added to ensure mEPSCs and not spontaneous EPSCs were captured. B Two representative traces of mEPSCs for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm 24–48 h post-transfection. Bar graph of mEPSC amplitude ( C ) and frequency ( D ) in NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm neurons. N = 10,13,12,13 NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm neurons respectively. One-way ANOVA followed by Tukey’s Multiple comparisons test. Cumulative probability graphs showing no change in mEPSC amplitude ( E ), but reduced frequency ( F ) in KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm neurons compared to NC-GFP. Kolmogorov-Smirnov Test. For graphs ( C , D ), error bars represent ± SEM. P-values are listed above respective comparisons. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Intellectual disability-causing mutations in KIF11 impair microtubule dynamics and dendritic arborization

doi: 10.1038/s41467-026-70522-z

Figure Lengend Snippet: A Timeline of experimental design to record miniature excitatory post-synaptic potential (mEPSCs) in mouse primary hippocampal culture expressing NC-GFP or KIF11 constructs. Tetrodotoxin (TTX) was added to ensure mEPSCs and not spontaneous EPSCs were captured. B Two representative traces of mEPSCs for NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm 24–48 h post-transfection. Bar graph of mEPSC amplitude ( C ) and frequency ( D ) in NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm neurons. N = 10,13,12,13 NC-GFP, KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm neurons respectively. One-way ANOVA followed by Tukey’s Multiple comparisons test. Cumulative probability graphs showing no change in mEPSC amplitude ( E ), but reduced frequency ( F ) in KIF11-OE, KIF11 Y81F , and KIF11 ΔCterm neurons compared to NC-GFP. Kolmogorov-Smirnov Test. For graphs ( C , D ), error bars represent ± SEM. P-values are listed above respective comparisons. Source data are provided as a Source Data file.

Article Snippet: DIV14-16 Primary hippocampal mouse neurons, plated in 35 mm Mattek No1.5 dishes were simultaneously transfected via combiMag and Lipofectamine with 0.5 μg EB3-miRFP703 (Addgene #79994) or mRuby-Synaptophysin [(pEF Synaptophysin-mRuby was a gift from Edwin Chapman (Addgene plasmid # 188980; http://n2t.net/addgene:188980 ; RRID:Addgene_188980)] or mApple-PSD95 [mApple-PSD95-N-14 was a gift from Michael Davidson (Addgene plasmid # 54941; http://n2t.net/addgene:54941 ; RRID:Addgene_54941)] and either 0.5 μg NC-GFP (Origene TR30013) or KIF11-shRNA-A (Origene TG501174) or tagged KIF11 constructs.

Techniques: Expressing, Construct, Transfection